<?xml version="1.0" encoding="UTF-8"?>
<item xmlns="http://omeka.org/schemas/omeka-xml/v5" itemId="83" public="1" featured="0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://omeka.org/schemas/omeka-xml/v5 http://omeka.org/schemas/omeka-xml/v5/omeka-xml-5-0.xsd" uri="https://cpw.cvlcollections.org/items/show/83?output=omeka-xml" accessDate="2026-07-21T17:25:20+00:00">
  <fileContainer>
    <file fileId="117">
      <src>https://cpw.cvlcollections.org/files/original/46b82661a240e855cd2e0eeaaeb35bd4.pdf</src>
      <authentication>70775e40cbf977e3097965551cb02186</authentication>
      <elementSetContainer>
        <elementSet elementSetId="4">
          <name>PDF Text</name>
          <description/>
          <elementContainer>
            <element elementId="92">
              <name>Text</name>
              <description/>
              <elementTextContainer>
                <elementText elementTextId="1280">
                  <text>The research in this publication was partially or fully funded by Colorado Parks and Wildlife.

Dan Prenzlow, Director, Colorado Parks and Wildlife • Parks and Wildlife Commission: Marvin McDaniel, Chair • Carrie Besnette Hauser, Vice-Chair
Marie Haskett, Secretary • Taishya Adams • Betsy Blecha • Charles Garcia • Dallas May • Duke Phillips, IV • Luke B. Schafer • James Jay Tutchton • Eden Vardy

�Virus Evolution, 2020, 6(1): vez058
doi: 10.1093/ve/vez058
Research article

Frequent cross-species transmissions of foamy virus
between domestic and wild felids

1

Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, CO, USA,
The Biodesign Center for Fundamental and Applied Microbiomics, Center for Evolution and Medicine, School
of Life sciences, Arizona State University, 1001 S McAllister Ave, Tempe, AZ 85281, USA, 3Department of
Veterinary Population Medicine, University of Minnesota, 1365 Gortner Ave, Falcon Heights, St Paul, MN
55108, USA, 4Colorado Parks and Wildlife, 317 W Prospect Rd, Fort Collins, CO 80526, USA, 5Department of
Fish, Wildlife, and Conservation Biology, Colorado State University, 1474 Campus Delivery Fort Collins, CO
80523, USA, 6Structural Biology Research Unit, Department of Clinical Laboratory Sciences, University of Cape
Town, Observatory, Cape Town 7925, South Africa and 7School of Biological Sciences, University of Tasmania,
Private Bag 55, Hobart, Tasmania 7001, Australia

2

*Corresponding author: E-mail: simona.kraberger@gmail.com
†
http://orcid.org/0000-0003-4111-2415

Abstract
Emerging viral outbreaks resulting from host switching is an area of continued scientific interest. Such events can result in
disease epidemics or in some cases, clinically silent outcomes. These occurrences are likely relatively common and can
serve as tools to better understand disease dynamics, and may result in changes in behavior, fecundity, and, ultimately
survival of the host. Feline foamy virus (FFV) is a common retrovirus infecting domestic cats globally, which has also been
documented in the North American puma (Puma concolor). The prevalent nature of FFV in domestic cats and its ability to
infect wild felids, including puma, provides an ideal system to study cross-species transmission across trophic levels
(positions in the food chain), and evolution of pathogens transmitted between individuals following direct contact. Here we
present findings from an extensive molecular analysis of FFV in pumas, focused on two locations in Colorado, and in relation to FFV recovered from domestic cats in this and previous studies. Prevalence of FFV in puma was high across the two
regions, �77 per cent (urban interface site) and �48 per cent (rural site). Comparison of FFV from pumas living across three
states; Colorado, Florida, and California, indicates FFV is widely distributed across North America. FFV isolated from domestic cats and pumas was not distinguishable at the host level, with FFV sequences sharing &gt;93 per cent nucleotide similarity.
Phylogenetic, Bayesian, and recombination analyses of FFV across the two species supports frequent cross-species spillover
from domestic cat to puma during the last century, as well as frequent puma-to-puma intraspecific transmission in
Colorado, USA. Two FFV variants, distinguished by significant difference in the surface unit of the envelope protein, were
commonly found in both hosts. This trait is also shared by simian foamy virus and may represent variation in cell tropism
or a unique immune evasion mechanism. This study elucidates evolutionary and cross-species transmission dynamics of a

C The Author(s) 2020. Published by Oxford University Press.
V

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/
licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited.
For commercial re-use, please contact journals.permissions@oup.com

1

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Simona Kraberger,1,2,* Nicholas M. Fountain-Jones,3 Roderick B. Gagne,1
Jennifer Malmberg,1 Nicholas G. Dannemiller,1 Ken Logan,4 Mat Alldredge,5
Arvind Varsani,2,6,† Kevin R. Crooks,5 Meggan Craft,3 Scott Carver,7 and
Sue VandeWoude1

�2

| Virus Evolution, 2020, Vol. 6, No. 1

highly prevalent multi-host adapted virus, a system which can further be applied to model spillover and transmission of
pathogenic viruses resulting in widespread infection in the new host.
Key words: feline foamy virus; retrovirus; cross-species transmission; puma; domestic cat; recombination.

1. Introduction

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Transmission of domestic animal pathogens at the wildlifeurban interface is highly relevant to disease emergence in new
host populations (Wiethoelter et al. 2015; Chaudhary et al. 2018;
Chiu et al. 2019), and is typically focused on virulent clinical outcomes in the new host. Enhanced ability to investigate the
virome of an organism has improved our ability to evaluate
transmission of viruses that do not result in acute death but result in chronic lifelong infection. Foamy viruses (FVs; family
Retroviridae) are an ancient lineage of endemic animal-infecting
retroviruses. Known to be largely host-specific, molecular
evidence suggests FVs have co-evolved with their hosts, which
include several non-human primate species, feline species,
cattle, and horses (Switzer et al. 2005; Rethwilm and Bodem
2013; Khan et al. 2018). Although no overt diseases have been directly attributed to FV infection, coinfections and interactions
with other viruses have been documented (Switzer et al. 2008;
Choudhary et al. 2013; Alais et al. 2018; Powers et al. 2018).
Numerous zoonotic transmissions of simian FV (SFV) from nonhuman primates to humans have been documented (MouingaOndémé et al. 2012; Richard et al. 2015; Buseyne et al. 2018).
Although not extensively investigated SFV transmissions have
not been recorded from human to human. Endogenous relic FVs
and FV-like elements have also been identified in numerous
animals including the aye-aye (Daubentonia madagascariensis)
genome (Han and Worobey 2012b), the ancient coelacanth fish
(Han and Worobey 2012a), the Tuatara (Wei et al. 2019) and
several other species (Xu et al. 2018).
FVs have linear �11–13 kb ssRNA genomes, containing two
long terminal repeat regions and three major canonical retroviral genes, gag, pol, and env. At least two additional accessory
proteins are encoded 30 region to the env. Like all retroviruses,
replication includes transcription from RNA to a DNA intermediate that integrates into the host genome. Although the viral
entry receptor(s) for FFV has not yet been identified, studies
have detected FVs in a broad range of tissue types and cells
(Luther, Nuttall, and Gibbons 1978; Bouillant and Ruckerbauer
�mak 2006; Murray and Linial
1984; Materniak, Bicka, and Kuz
2006; Kehl, Tan, and Materniak 2013) with evidence suggests
that the oral mucosa is the primary region for FV replication
(Winkler, Löchelt, and Flower 1999; Calattini et al. 2006).
Of all the FVs, the primate FVs have been the most extensively researched to date, with several genetically distinct
species groups having been identified in both Old World and
New World primates. Phylogenetic analysis supports virus–host
coevolution history, with additional evidence of occasional
cross-species transmission mostly within the simian system
(Switzer et al. 2004; Richard et al. 2015) and coinfection with
multiple FV strains/genotypes (Liu et al. 2008). Based on the
notion that FVs have co-evolved with their hosts, long-term
molecular clock investigation indicates primate FVs have a
slower nucleotide substitution rate than other RNA viruses and
are the slowest evolving RNA viruses documented (Switzer et al.
2005). Recombination also plays an important role in FV evolution (Richard et al. 2015; Ensser et al. 2018). A presumed result
of ancient recombination is the presence of two circulating

serotypes which differ in a highly variable receptor binding
encoding, also referred to as the surface unit (SU) region in the
env gene observed in FV of both felines and primates (Winkler
et al. 1998; Bleiholder et al. 2011; Galvin et al. 2013; Richard et al.
2015; Lambert et al. 2018).
Unlike primate FVs, very little is known about the genetic diversity, evolutionary dynamics, and ecology of feline FV (FFV).
FFV infection of domestic cats is broadly distributed globally,
with prevalence studies in Europe (Bleiholder et al. 2011),
Australia (Winkler, Löchelt, and Flower 1999), Asia (Nakamura
et al. 2000; Phung et al. 2001), and the USA (Powers et al. 2018),
indicating FFV is endemic worldwide with these studies showing variable prevalence between 30 and 70 per cent. Although
no consistent sex bias has been demonstrated, an increased
prevalence is linked with aging of the animals (Winkler,
Löchelt, and Flower 1999; Nakamura et al. 2000; Bleiholder et al.
2011). Oral mucosa is known as a key site of domestic cat FFV
active replication (Cavalcante et al. 2018), with close social or
conflict interactions such as grooming and/or biting likely primary transmission pathways (Winkler, Löchelt, and Flower
1999). This mode of transmission is also supported in simian
populations, where biting and predation has been shown to be a
major source of transmission within and between species
(Calattini et al. 2004; Liu et al. 2008; Betsem et al. 2011).
Only four complete FFV genomes have been described from
domestic cats that is, two from the USA (Helps and Harbour
1997; Winkler et al. 1998), and one each from Japan (Hatama
et al. 2001), and Australia (Bodem et al. 1996). In wild felids, FFV
infections have been documented using serology in European
wildcats (Felis silvestris) from Scotland (Daniels et al. 1999) and
leopard cats (Prionailurus bengalensis) in Vietnam (Nakamura
et al. 2000). FFV has also been detected by partial genome sequencing in Iriomoteiriomote cats (subspecies P. bengalensis iriomotensis) in Japan and leopard cats in Argentina (Phung et al.
2001). A recent serologic survey of pumas in three USA states
(California, Colorado, and Florida) is the first large-scale prevalence study in a wild felid species showing high levels of FFV
seroconversion in the three areas, documenting �80 per cent
positivity (Kechejian et al. 2019). Additionally, two full length
FFV genomes have been recovered from the North American
puma (Kehl et al. 2013), which genetically are highly similar to
those found in domestic cats (Phung et al. 2001; Kehl et al. 2013).
In an effort to gain important insights into the origin, molecular ecology, and transmission dynamics of FFV in wild and domestic felids, we undertook the first extensive molecular survey
and genetic analyses of FFV in wild felids, focusing on puma
from two geographically distinct regions in Colorado, USA. As
top predators, there is accumulating evidence that this species
is at higher risk for pathogen spillover from prey (Franklin et al.
2007; Troyer et al. 2014; Lee et al. 2017a; Kellner et al. 2018), including spillover of feline leukemia virus from domestic cats to
the endangered Florida panther with significant clinical impact
(Cunningham et al. 2008; Chiu et al. 2019). We additionally
undertook a comparative analysis to understand broader host–
virus dynamics, analyzing FFV sequences from free-ranging
feral domestic cats from Colorado and Australia, and freeroaming pumas from Florida and California. Our analysis

�S. Kraberger et al.

supports frequent cross-species transmission of FFV during the
last century along with puma-to-puma transmission, resulting
in wide distribution and high prevalence of FFV in Puma across
Colorado. As a result of these virus–host dynamics FFV sequences derived from puma living in Colorado, California, and endangered Florida panthers share high levels of similarity to FFV
from domestic cats and do not form distinct species clades
phylogenetically.

3

2.1 Ethics statement
Puma samples were collected as part of ongoing studies at
Colorado Parks and Wildlife (CPW) between 2005 and 2014, and
provided to Colorado State University (CSU) for diagnostic evaluation. Domestic cat samples were collected by collaborating
shelters and sent to CSU during the same period. Blood samples
from these studies have been archived and reused for many
unique analyses. CSU and CPW Institutional Animal Care and
Use Committees reviewed and approved this work prior to initiation (CSU IACUC protocol 05-061A).
This work was performed in accordance with United States
Department of Agriculture Animal Welfare Act and The Guide
for the Care and Use of Laboratory Animals. CSU Public Health
Assurance number is D16-00345. CSU is accredited by AAALAC
International.

2.3 DNA isolation
Whole blood samples were processed using a phenolchloroform extraction as described by Di Pietro et al. (2011). Two
hundred microliters of whole blood per sample were processed,
and all subsequent reagent quantities were made proportional

2.2 Sample collection
Whole blood samples from individual pumas and domestic
cats were used for FFV analysis. Samples were collected

Western Slope (WS)

Front Range (FR)
Mo

nt

Location and FFV status
of puma
FFV positive
FFV negative

ro

se

Loveland

Longmont
eway

Ridg

Boulder
0

10

20

30

40

Km

B

Wyoming

Nevada

60

Colorado

Denver
Kansas

FFV prevalence (%)

80

40
New Mexico

20
0

WS

FR

Region

WS+FR

0

10

20

30

40

Km

Figure 1. FFV prevalence is high in pumas in the WS and FR. (A) Study areas and sampling sites for puma tested for FFV in Colorado, USA. (B) Bar graph showing prevalence of FFV across the two regions (WS and FR) and the average across both regions (WSþFR). Maps were sourced from the Multi-Resolution Land Characteristics consortium (Homer et al. 2015).

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

opportunistically by collaborators and demographic information collected as previously described (Bevins et al. 2012; Carver
et al. 2016), cold transported and stored at �80� C.
Colorado puma samples were collected by CPW as part of
ongoing monitoring and study efforts in two regions of the
Rocky Mountains in Colorado, USA (Fig. 1A). The Front Range
(FR) is situated along the wildland–urban interface west of the
city of Boulder, where animals were sampled as part of a study
evaluating puma-human interactions. The Western Slope (WS)
is a largely wildland/rural area on the Uncompahgre plateau
near the towns of Montrose and Ridgway, where pumas were
studied to evaluate impacts of hunting on population dynamics.
Samples were collected 2007–13 in the FR and 2005–14 in the
WS. Florida puma samples (whole blood) were collected by the
Florida Fish and Wildlife Conservation Commission in an ongoing study to survey health and population management efforts.
Colorado domestic cat samples were collected from freeranging cats on entry to shelters close to the FR and WS regions in
Colorado. Two shelters in Boulder (Boulder Humane Society and
Community Cat Care Shelter) and one in Ridgway (Ridgway
Second Chance Shelter) provided samples as previously described
(Bevins et al. 2012; Carver et al. 2016). Australian domestic cat
blood samples were opportunistically collected by the Beatty Lab
at The University of Sydney, from pet domestic cats following routine clinical care at the university Veterinary Teaching Hospital.

2. Materials and methods

A

|

�4

| Virus Evolution, 2020, Vol. 6, No. 1

according to the recommended initial blood volume. Extracted
DNA was quantified using a QuBit 2.0 fluorometer (Thermo
Fisher Scientific, USA).

2.4 Screening puma samples for FFV using quantitative
real-time PCR

2.5 Statistical analyses of the effects of sex and age on
FFV status in puma
We evaluated the effects of sex (male/female) and age (young/
adult) on FFV infection in pumas using Bayesian Generalized
Linear Mixed Models (GLMMs), with location as a random effect,
and sex, and age as fixed effects. Models tested whether a puma
was qPCR negative or positive for FFV as a function of sex, age,
and an interaction between sex and age. Using non-informative
priors, models ran for 50,000 iterations, after a burn-in of 10,000
iterations and thinning of 10, yielding 4,000 values to derive parameter posterior means. Convergence was assessed visually by
comparing the posterior distributions of multiple runs of each
model. GLMM model weights and averaged coefficients were
also calculated to examine the effect sizes of variables. All statistics were implemented in Program R (R Development Core
Team, Vienna, Austria) version 3.3.3, using the ‘MCMCglmm’
package for the GLMMs (Supplementary Table S1).

Proviral sequences were recovered from a total of eighty-seven
samples from Colorado pumas which were qPCR FFV positive.
From these full genomes were isolated from twenty-eight individuals, and the pol and/or env gene regions from the remaining
fifty-eight (Supplementary Table S2). Due to low DNA quantity,
DNA degradation, or sample availability, these genetic regions
(pol and env gene) could not be recovered from the remaining
qPCR positive pumas. Additionally, pol and env gene sequences
were amplified from three puma samples from Florida which
were previously identified as FFV positive either by enzymelinked immunosorbent assay (ELISA) or qPCR. Proviral sequences were recovered from nineteen domestic cat samples from
Colorado and Australia. Six full genomes from Colorado domestic cats. FFV pol was recovered from an additional eleven
Colorado cats, and env also was recovered from eight of these
cats. FFV pol and env sequences from two domestic cats from
Australia and three Florida panthers were also recovered and
used in this analysis (Supplementary Table S2). Sequence data
has been deposited in Genbank, accession numbers: MH633335MH633442.
Nested PCR was used to recover proviral sequences for
Sanger sequencing as follows: First Round 5 ml Kapa Hotstart
Hifi polymerase (Kapa Biosystems, USA), 2 ml H2O, 1 ml of both
the forward and reverse primer (Table 1) and 2 ml of DNA.
Second Round—10 ml Kapa Hotstart Hifi polymerase (Kapa biosystems, USA), 6 ml H2O, 1 ml of both the forward and reverse
primer (Table 1) and 2 ml of R1 PCR product. Cycling conditions
were followed according to manufacturer’s specifications and
an annealing temperature of 60� C. Reactions were run on a
C1000 Touch Thermal Cycler (Bio-Rad, USA). Full genomes were
amplified in two �6.3 kb fragments with �1 kb overlapping
regions. PCR products were resolved on a 0.7 per cent agarose
gel using electrophoresis for 30 min at 110 V. Bands of the
correct size were excised from the gel and purified using a
MEGAquick-spinTM Total Fragment DNA Purification Kit
(iNtRON Biotechnology, Korea). Purified DNA was then cloned
using pJET 1.2 blunt vector using the CloneJET PCR Cloning Kit
(Thermo Fisher Scientific, USA) and XL1-Blue Escherichia coli
competent cells (Agilent technologies, USA). Plasmids were isolated using DNA-spin Plasmid Purification Kit (iNtRON

Table 1. Primer sequences used to recover the full genome, pol, and env proviral sequences.
Primer name
0

Full FFV genome—5 half

Nested round

F/R primer

1

F
R
F2
R2
F
R
F2
R2
F
R
F2
R2
F
R
F2
R2

2
Full FFV genome—30 half

1
2

FFV env gene

1
2

FFV pol gene

1
2

Product size of final amplicon
�6.3 kb

�6.3 kb

�3.2 kb

�3.9 kb

Primer sequence
GAATTCTCACAGAGGAGAATACTCTCTGC
GCAACTCAGGATGAGTCAACTGAAGTTTCTG
GTCAACAAAAGCTCTTTTATCCCGGAG
TGGCCTAGATGGTCCACTATAATCACA
GTTGGAGGGAAATTCCTCCTTCCCGAG
ACTGTCGTGGTCTATACCTGGGATAGGTTAG
AGTCATGCAAGACGAGAAGCCGT
CACTTTTCCCCAGGAATAGAGAAACAC
CTAAGTGGAGGAAGCCTACAAAGG
CCACTTTCAGGAATTCCCTTATGACATTG
GATTATAGTGGACCATCTAGGCCAAC
CTGGTATGCATAGACAAAAGAGCTAAAG
GTAATCCTCAACAGCAGGGACC
GGAAGTATTTCCTCCCACGGTTAC
ATCAAGGACCTCGGCCAG
CAGGATGTGTTATTGCTTCTTTCCATTG

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

A total of 169 Colorado puma samples (71 from the FR and 98
from the WS) were screened for FFV proviral DNA using methods
outlined in Lee et al. (2017b) using a specific quantitative realtime (q)PCR screening protocol. The following protocol was used;
5 ml of iTaqTM Universal probe supermix (Bio-Rad, USA), 1 ml
FFVgag F (10 mM) 50 -GGACGATCTCAACAAGGTCAACTAAA-30 , 1 ml
FFVgag R (10 mM) 50 -TCCACGAGGAGGTTGCGA-30 , 0.2 ml FFVgag
probe (10 mM), 5.8 ml sterile distilled water and 2 ml DNA (30–100 ng)
template. DNA samples were run in triplicate alongside negative
controls (DNA from known FFV negative domestic cats), positive
controls (DNA from known experimentally infected FFV domestic
cats), and plasmid dilution standards of 106–101 copies in duplicates. Reactions were run on a CFX Connect real-time PCR
Detection System (Bio-Rad, USA) using the following cycling conditions: 95� C for 3 min followed by forty cycles of 95� C for 10 s and
60� C for 40 s (Lee et al. 2017b). Samples were considered positive
only if two or more replicates were positive within the standard
curve of detectable copies and within thirty-eight cycles.

2.6 Recovery of FFV genetic proviral sequences—full
genome, pol, and env gene regions

�S. Kraberger et al.

Biotechnology, Korea) and subsequently Sanger sequenced using primer walking at Quintarabio in San Francisco, CA. Genetic
sequences were verified and assembled using Geneious 7.0.6
(Biomatters Ltd., New Zealand). Datasets of full genomes, pol
and env (which both include pol and env regions from the full genome isolates) were compiled together with those downloaded
from the public database GenBank. Nucleotide and amino acid
datasets for both genes were used for downstream analyses.

2.7 Construction of phylogenetic trees

2.8 Recombination within pol and env gene regions
Recombination analyses for pol and env was undertaken using
RDP4 software (Martin et al. 2015). Aligned datasets were
uploaded and auto mask for optimal recombination detection
applied. Events with three or more methods showing associated
P-values &lt;10�3 combined with strong phylogenetic support
were considered as genuine events. Recombination-free datasets with recombination regions removed from all sequences
were generated for downstream Bayesian evolutionary analysis
by sampling trees (BEAST) analyses.

2.9 Bayesian analyses of FFV
2.9.1 FFV maximum likelihood phylogenetic tree
A maximum-likelihood phylogenetic tree was constructed from
pol and env gene sequences using recombination-free datasets
generated in RDP4 (Martin et al. 2015). This analysis was conducted using an Subtree pruning and regrafting (SPR) branchswapping heuristic search in PhyML 3.0 (Guindon et al. 2010)
and 1, 000 bootstrap replicates were used to estimate node robustness in the phylogeny. As part of this analysis, we specified
the smart nucleotide selection model (Lefort, Longueville, and
Gascuel 2017), which identified GTR þ C4 model of nucleotide
substitution model as most appropriate for this dataset. Using
this tree, we performed a linear regression of root-to-tip divergences using the TempEst routine to check for temporal signal
in the FFV sequences (Rambaut et al. 2016).
2.9.2 Time-calibrated phylogenetic trees and discrete trait analysis
To understand the temporal dynamics of FFV and to quantify
host-switching over time, we constructed time-calibrated phylogenies in BEAST version 1.10 using the pol gene only; env was
excluded from this analyses due to the high level of diversity
resulting in a lack of temporal signal. Nonetheless, we do estimate the sub/site per year for both pol and env genes. Host and
location were analyzed as discrete traits (Drummond and
Rambaut 2007). Based on the two factors 1, domestic cat FFV
likely represents a global endemic viral population due to domestic cat movement across the globe, and 2, we have a smaller

5

relative representation of FFV from domestic cats compared
with puma, we assigned sequences from domestic cats to one
trait. To assess FFV movement between domestic cat and
pumas across locations, FFV sequences from puma were
assigned as traits based on their location (FR, WS, California,
and Florida). We used a symmetric trait substitution model in
which transition rates are assumed to occur at the same rate.
Bayesian stochastic search variable selection procedure was
employed to estimate host transition rates. SpreaD3 (Bielejec
et al. 2016) was used to calculate Bayes Factor (BF) support for
the most likely host transitions. Additionally, we used the same
parameters but with a discrete trait asymmetrical model to test
if cross-species transmission was more likely from domestic cat
to puma or vice versa (i.e. we only used domestic cat and puma
as traits, this data is shown as Supplementary Fig. S3), wellsampled puma populations were used for this, California and
Florida puma were therefore excluded to simplify. Support for
events with BF 3–10 ¼ substantial, 10–30 ¼ strong, 30–100 ¼ very
strong support, and &gt;100 ¼ decisive (Jarosz and Wiley 2014).
A relaxed (uncorrelated lognormal) molecular clock with
continuous quantile parametrization was specified, and
Bayesian skyline with time-aware Gaussian Markov random
field coalescent prior was utilized (Minin, Bloomquist, and
Suchard 2008). We used default priors and ran two independent
MCMC (Markov chain Monte Carlo) analyses for 500 million
steps and sampled every 500,000 states. Convergence of parameter estimates was assessed based effective sample size (ESS)
(estimates with an ESS &gt; 200 were considered converged).

3. Results
3.1 Prevalence, diversity, and demographics
qPCR screening of FFV in 169 pumas from two locations in
Colorado revealed a higher prevalence of FFV in the FR of 55/71
(�77%) compared with the WS which had a 48/98 (�48%), and
with a prevalence of 103/169 (�60%) across both regions
(Fig. 1B). Nucleotide similarity of FFV full genomes isolated from
domestic cats and puma (including those from Florida,
Australia, and USA, and international isolates available in the
public database GenBank) range from 93 to 100 per cent pairwise nucleotide similarity (Supplementary Data S1). Amino acid
pairwise comparison of Pol range from 94 to 100 per cent identity,
whereas Env similarity ranges from 81 to 100 per cent
(Supplementary Data S1). The SU in the Env protein is the most
genetically diverse region on an amino acid level (Supplementary
Data S1). Similar to findings for FFV from domestic cats (Winkler
et al. 1998), two distinct Env genotypes were identified, with
amino acid identity ranging from 93 to 100 per cent within genotypes, and 82 to 85 per cent identity between genotypes
(Supplementary Data S1). Nucleotide diversity across the env
gene, within each Env genotype group, is similar to that across
the rest of the genome; �94–100 per cent (data not shown).
Prevalence in males and females was similar, with 60.3 per
cent of males and 63.2 per cent of females identified to be qPCR
positive. GLMMs analyses showed incidence of detection increased with age (43.8% for juveniles and 64.3% for adults;
Supplementary Fig. S1). For a subset of tested individuals, sex
and/or age information was unavailable (n ¼ 67). Our analyses,
however, showed that infection was not strongly predicted by
sex or age (Supplementary Fig. S1). Phylogenetically groupings
did not demonstrate distinctive specific sex or age trends; however, juvenile isolates clustered with isolates recovered from
adults (Fig. 2).

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

The full genomes and Pol and Env amino acid datasets were
used to construct maximum likelihood phylogenetic trees. The
best fit substitution models were inferred in MEGA 5.3 for the
full genomes (GTRþIþG) using jModelTest (Posada 2009), and
for the Pol and Env datasets (JTTþG) using ProtTest (Darriba
et al. 2011). Trees were constructed using PhyML (Guindon et al.
2010) with approximate likelihood branch support. Branches
presenting &lt;80 per cent support were collapsed in TreeGraph2
(Stöver and Müller 2010). Trees were all midpoint rooted. Editing
of trees was undertaken using FigTree V1.4.3 (Rambaut 2012)
and demographic illustrative data were overlaid onto the Pol
phylogenetic tree using ITOL v4.2.3 (Letunic and Bork 2016).

|

�6

| Virus Evolution, 2020, Vol. 6, No. 1

Sam
Loc pling
atio
n

Iso
hos late /
t

Sampling location
Front Range, CO, USA
Western Slope, CO, USA
Florida, USA
California, USA
State unknown, USA
Japan
Australia
Age
Adult
Juvenile
Unknown

Sex

Host

Domestic cat
Male
Puma
Female
Unknown

Figure 2. FFV from circulates in both domestic cats and puma. Domestic cat FFV Pol protein sequences are interspersed throughout the maximum likelihood phylogenetic tree, and cluster closely to FFV isolated from pumas. Isolate names in bold font were sequenced in this study and font color indicates host species, light blue domestic cat and dark blue puma. Location information is marked by colored squares on the periphery of the tree (red, FR, Colorado; yellow, WS, Colorado; blue, Florida;
purple, California; brown, State unknown; dark green, Japan; light green, Australia) and demographic information on the branch tips (black, adult; gray, juvenile; white,
unknown age and square, male; circle, female; triangle, unknown).

3.2 Phylogenetic analyses of full genome, Pol, and Env

3.3 FFV recombination

The genetic relationship of FFV in puma compared with domestic
cats in maximum likelihood phylogenetic trees highlights a single virus–dual host dynamic which is clearly demonstrated in all
three phylogenies representing Pol (Fig. 2), Env (Fig. 3), and the
full genome (Supplementary Fig. S2). There is strong evidence for
transmission of FFV between FR and WS locations, though
some subclades indicate regionally specific viral populations
(Figs 2 and 3). Domestic cat FFV isolates from the USA, internationally sourced isolates, and puma FFV isolates from Florida
and California are interspersed throughout the trees (Figs 2 and
3). The Pol protein phylogeny documents that internationally
sourced domestic cat sequences, although interspersed, sit basal
to puma and domestic cat isolates from Colorado (Fig. 2). This
pattern was not indicated for Env; however, two SU clades are
evident in the Env protein phylogenetic tree (Fig. 3); isolates with
these two highly divergent SU regions were found to circulate
in both host species and across locations globally.

Recombination analyses of pol and env gene sequences from domestic cats and puma showed high levels of recombination in
both open reading frames (Fig. 4A and B). A total of twelve
events in pol (Fig. 4A) and eleven in env (Fig. 4B) were strongly
supported. Recombination events with inferred parental FFVs
originating from both species were identified in 9/12 (75%)
events in pol and 8/11 (�72%) events in env (Fig. 4A and B and
Supplementary Data S2). Recombination breakpoint hot and
cold spots were identified in both genes, including one hotspot
in the 50 region of pol, a hotspot as well as a cold spot in the 50 region of env, and a hotspot in the SU region of env (Fig. 4C and D).

3.4 Substitution rates and Bayesian ancestral
reconstruction of location and host state
To evaluate substitution rates, we undertook Bayesian analyses
of the pol and env recombination-free datasets. Pol displayed the

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

0.01 amino acid subs/site

�S. Kraberger et al.

Sampling location
Front Range, CO, USA
Western Slope, CO, USA
Florida, USA
California, USA
State unknown, USA
Japan
Australia

&gt;0.95
&gt;0.9-0.95
&gt;0.8-0.9

Host
Domestic cat
Puma

Full Env maximum likelihood tree

X424 FR

X1402 FR 2011-23-02
X1671 FR 2012-08-12
X1393 FR 2011-01-03
X1069 WS 2010-13-01
X1364 FR 2010-24-01
X1390 WS 2011-15-02
X286 WS 2008-15-02
X285 WS 2008-21-02
X1670 WS 2013-29-01
X1692 WS 2014-10-02
X1667 WS 2013-14-02
X1399 WS 2011-08-03
X142 WS 2005-02-24
X132 WS 2006-19-04
X140 WS 2005-18-02
X300 WS 2008-12-03
X1691 WS 2014-12-02
X1369 WS 2011-01-01
X1370 WS 2011-20-01
X127 WS 2006-10-03
X1403 FR 2011-06-03
X1404 FR 2011-06-03
X1310 FR 2010-21-07
X1131 WS 2010-24-02
X1031 FR 2009-17-11

0.01 amino acid subs/site

Clade B

X138 WS 2007-01-12
X1251 WS 2010-07-05
X124 WS 2006-04-01
X1406 FR 2011-18-03
X1189 FR 2010-29-03
X1550 FR 2011-13-04
X433 FR 2009-27-01
X1368 WS 2011-11-01
X128 WS 2006-23-03
X1379 FR 2011-06-02
X1685 WS 2014-03-01
X1064 FR 2010-14-01
X1375 FR 2010-31-12
X1549 FR 2011-19-05
X1408 FR 2011-18-03
X130 WS 2005-21-01
AB052796 DC-JP
U85043 DC-US
X1656 FR 2012-12-03
X1676 FR 2012-30-03
X1324 FR 2010-09-14
AB052797 DC-US
Baj AU 2014-26-03
X367R2 FR 2009-17-12
X1329 FR 2010-22-09
X1190 FR 2010-04-04
X296R1 FR 2010-25-03
X1372 FR 2011-06-01
X287 FR 2007-14-06
X301 WS 2008-26-03
X1038 FR 2009-24-11

Figure 3. Env protein maximum likelihood phylogenetic tree indicates FFV does not exhibit strong host or geographic structure. Clades A and B of FFV Env isolates are
circulating in both host species and across locations broadly. Isolate names in bold font were sequenced in this study and font color indicates host species (light blue,
domestic cat; dark blue, puma). Location information is marked by colored squares on the periphery of the tree (red, FR, Colorado; yellow, WS, Colorado; blue, Florida;
purple, California; Brown, State unknown; dark green, Japan; light green, Australia). The two Env SU Clades A and B are highlighted.

slowest substitution rate [2.640 � 10�4; 95% highest posterior
density (HPD) interval 1.480 � 10�4, 3.768 � 10�4], whereas env
substitution rates were comparatively faster [3.872 � 10�4; 95%
HPD interval 1.85 � 10�4, 6.025 � 10�4].
Further BEAST analyses on only the pol (the high level of diversity present in the env resulted in a lack of temporal signal),
was used to investigate historical geographic movements, and

host species transmission patterns. Four trends of FFV transmission were well supported (Fig. 5): 1, domestic cat—FR puma (BF ¼
6, posterior probability ¼ 0.84); 2, domestic cat—California puma
(BF ¼ 16, posterior probability ¼ 0.93); 3, domestic cat—WS puma
(BF ¼ 1,155, posterior probability ¼ 0.99); and 4, puma—puma
transmission between individuals from the FR and WS (BF ¼
46,263, posterior probability ¼ 1.0). Further, analysis of host

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

0.03 subs/site

7

Clade A

X1041 FR 2009-08-12
X1080 WS 2010-20-01
X1078 WS 2010-26-01
X1641 FR 2011-14-10
X1675 FR 2012-02-12
X590 WS 2009-11-02
x1842 FL 1990-28-02
X1033 FR 2009-18-11
X1259 WS 2010-06-06
X1049 FR 2009-15-12
X1357 FR 2010-07-12
X423R1 FR 2010-03-02
X1405 FR 2011-09-03
X1674 FR 2013-04-01
X879 WS 2009-21-05
X1045 FR 2009-15-12
X387 WS 2008-25-11
X1371 WS 2011-21-01
X131 WS 2006-15-04
X288R1 FR 2008-04-29
X1346 FR 2010-26-11
X1077 FR 2010-28-01
X1678 FR 2013-19-03
X1129 WS 2010-25-02
X1376 FR 2011-20-01
X297 FR 2008-29-03
X290R1 FR 2009-04-12
X1834 FL 1988-01-06
x1739 FL 1995-16-02
Y08851 AU
X1076 FR 2010-28-01
X1499 WS 2011-17-04
KC292054-55 2005-23-05
X1217 FR 2010-22-04
Betsie AU 2014-04-06
X1257 WS 2010-06-06
X1688 WS 2014-05-02
X1058R1 WS 2011-04-03
X1391 WS 2011-24-02
X135 WS 2006-14-12
X1666 WS 2013-14-03
X1651 WS 2012-14-2
X1553 FR 2011-09-04
X1120 FR 2010-22-02
X1121 FR 2010-23-02
X1151 FR 2010-13-03
X1347 FR 2010-26-11
X429 FR
X1400 WS 2011-08-03
X1694 WS 2014-08-03
X1695 WS 2014-08-03
X1668 WS 2013-04-02

aLRT branch support

|

�A

| Virus Evolution, 2020, Vol. 6, No. 1

pol

Recombinant(s)

C

Puma-WS (n=1/43)
Puma-WS (n=21/43), Puma-FR (n=11/44)
DC-US (n=1/2), DC-FR (n=2/9)
DC-FR (2/9), Puma-WS (n=1/43)
Puma-FR (n=2/44)
DC-FR (n=1/9), DC-JP (n=1/1),
DC-US (n=1/2)
DC-AU (n=1/3)
Puma-FR (n=1/44)
Puma-FR (n=8/44), Puma-WS (n=4/44),
DC-US (n=1/2)
Puma-FR (n=1/44)
Puma-WS (n=1/43)
Puma-FR (n=10/44), Puma-WS (n=8/43)
Puma-FR (n=4/44), Puma-WS (n=1/43)

1
2
4

3
5

6
7
8
9
10
11
12

D
7
5.25
3.5
1.75
0
1

867
1734
2602
Nucleotide position in relation to X1499

env

Recombinant(s)

3468

Fig A &amp; B
Host orgin of recombinant
Domestic cat
Puma
Host origin of parental
sequences
Both species
Single species

1
2
10

22
3
4

10

4
5
5

9
5

6

7
8
10
11

Fig C &amp; D
Breakpoint number
Local 95% confidence interval
Local 99% confidence interval
Global 95% confidence limit
Global 99% confidence limit

8
6
4
2
0
1

736
1473
2210
Nucleotide position in relation to X1499

2946

Recombination breakpoint
hotspot
Recombination breakpoint
coldspot

Figure 4. Recombination is common in genomes of domestic cat and puma FFV. Recombination analyses of FFV of (A) pol and (B) env sequences. Gene region is displayed at the top of each analyses for reference and recombinant regions depicted for each event below Host species origin of recombinant is indicated by color of recombinant names (light blue, domestic cat; dark blue, puma) and host species origin of minor parental sequence, single—puma or domestic cat or both—puma and
domestic cat, by shading of recombinant region (black, single; gray, both). Number of individuals with recombinant sequences is shown following host and region
name (C) Breakpoint frequency plot highlights recombination breakpoint hotspot in the 50 of pol. (D) Graphic highlights recombination breakpoint hotspots, in the 50
and SU region, and coldspot in the 50 region of env.

transmission using an asymmetrical model of discrete trait transition (Supplementary Fig. S3) shows two supported trends of
FFV transmission: puma to domestic cat (BF ¼ 20, posterior probability ¼ 0.99) and domestic cat to puma (BF ¼ 8,155, posterior
probability ¼ 1). Supported nodes indicate that FFV has likely
been present in Colorado at least 70 years. Four major clades are
present, one which consists primarily of domestic cats, two primarily puma and a fourth that includes both domestic cats and
puma from three sites in the USA (Fig. 5).

4. Discussion
4.1 High prevalence of FFV in puma
The high prevalence (�60%) of FFV identified in Colorado puma
population’s documents endemic infection in this region
(Fig. 1B). This prevalence is on the high end of what has been
reported in domestic cat populations (range 8–80%, (Winkler,
Löchelt, and Flower 1999; Nakamura et al. 2000; Powers et al.
2018). Reported seroprevalence was even higher (77.3%) which
is likely due to higher sensitivity of ELISA compared with PCR
(Kechejian et al. 2019). Identification of FFV positive pumas
from Florida and California indicates this virus is not limited to
Colorado puma populations, and is widely spread across freeranging populations. We found little statistical support for increased infection rate with sex (GLMM pMCMC &gt; 0.05) or age
(GLMM pMCMC &gt; 0.05), indicating that FFV is readily transmitted between the sexes, and is not age dependent—providing
strong support for social transmission mechanisms such as
grooming. Although sex and age were not found to be risk factors for FFV infection, their inclusion in our GLMMs improved
model fit suggesting they may still influence FFV transmission.
Recent work by our research group has indicated age and/or sex
to be risk factors that vary by population (Kechejian et al. 2019),
so the impact of these factors on risk of infection has yet to be
fully elucidated. Juvenile-originating FFV sequences were dispersed throughout the phylogeny, and commonly nested most
closely to those from adults, a pattern suggesting transmission
from parent to offspring (Fig. 2). Additionally, lack of phylogenetic

stratification by sex indicates transmission between males and
females occurs commonly (Fig. 2).

4.2 Complex phylogeny of puma FFV indicates spillover
and puma to puma transmission
The phylogenetic relationship of FFV from puma and domestic
cats highlights a single virus–dual host dynamic, supporting domestic cat to puma transmission and puma to puma transmission. This is displayed in both the Pol and Env protein
phylogenetic trees independently (Figs 2 and 3) with the presence of 1) puma only clades and 2) domestic cat isolates cluster
throughout the tree, basal to or within puma dominated clades.
Viral spillover resulting from trophic interactions has been
demonstrated for other retroviruses, including feline immunodeficieny virus - FIVlru, transmission from bobcat (Lynx rufus) to
puma (Lee et al. 2017a), feline leukemia virus transmission from
domestic cat to puma (Cunningham et al. 2008; Chiu et al. 2019),
and also for other pathogens such as Mycoplasma haemominutum
from bobcat and domestic cat to puma (Kellner et al. 2018).
Recent reports that domestic animals are increasingly preyed
upon by puma near human populated areas, including the FR
study site examined here (Moss et al. 2016), is a strong indicator
that increases in viral spillover from domestic cats to pumas are
likely to be observed with intensified urbanization. Clades that
are predominantly comprised of isolates from one geographic
area in Colorado (FR or WS; Figs 2 and 3 and Supplementary Fig.
S2), but include a single isolate from the other location in
Colorado (FR or WS), could represent either introductions from
a migrant puma, or domestic cat spillover events.

4.3 Two co-circulating genotypes of FFV are pervasive in
puma and domestic cats
Phylogenetic analysis of Env proteins indicates two distinct
clades denoting the two SU Env genotypes (Clades A and B;
Fig. 3). Both SU Env genotypes were isolated from domestic cats
and pumas, and were found in the WS and FR of Colorado, and
globally among domestic cats. This indicates both genotypes

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Breakpoints per 200 nt window

DC-FR (n=4/9), DC-WS (n=2/5),
Puma-WS (n=5/43), Puma-CA (n=2/2)
Puma-FR (n=1/44)
Puma-FR (n=9/44), Puma-WS (n=9/43)
Puma-FR (n=7/44)
DC-FR (n=1/9)
Puma-WS (n=1/43)
DC-AU (n=1/3)
Puma-FR (n=2/44)
Puma-FR (n=2/44), Puma-WS (n=1/43),
DC-WS (n=1/5)
Puma-WS (n=1/43)
DC-US (n=1/2)

B

Breakpoints per 200 nt window

8

�S. Kraberger et al.

Posterior probability Location / host species
&gt;0.90
&gt;0.8-0.9
0.7-0.8

1950

9

Bayes factor

DC
DC

10 years

6
16

FR
CA

1975

DC
FR

1155
46263

WS
WS

2000

Figure 5. FFV phylogeny indicates puma FFV originated from cross-species transmission followed by efficient puma-to-puma spread. Bayesian maximum clade credibility tree of pol showing location and host movement of the virus over time. BF supported movements across the tree show supported movements between 1, domestic cats (green) and California puma (purple); 2, domestic cats (green) and WS puma (yellow); and 3, puma from the FR (red) and WS (yellow). Posterior probability
indicated by circles as indicated in legend (white, 0.7–0.8; gray, �0.8–0.9, black; &gt;0.9).

are adapted to both species and frequently co-circulate in
populations, thereby suggesting a synergistic relationship. The
dominant presence of both genotypes circulating among both
host species indicates that despite the high level of amino acid
variability in this SU region, these genotypes are well adapted to
both host species. This observation parallels recent studies of
two unique Env SFV subtypes in non-human primates (Richard
et al. 2015; Lambert et al. 2018). In domestic cats analyses clearly
identified these two genotypes using serotype-specific PCR
assays, sequencing and neutralizing assays (Winkler et al.
1998). A later study targeted Env-specific antibodies using a
ElpSU antigen ELIZA; however, this assay was unable to distinguish-specific serotypes (Bleiholder et al. 2011). It has been suggested that variance in SU allows the virus to utilize multiple
receptors in a genotype-specific manner, or perhaps they have
different cell tropisms relevant for the biology of FFV. Receptor
interference studies however support that all FVs, despite having a broad host range, may gain viral entry via the same cell
surface receptor (Hill, Bieniasz, and McClure 1999; Berg et al.
2003). Cellular expression of a FV Env has been shown to induce

superinfection resistance, thereby acting as a barrier to infection by other FV’s (Hill, Bieniasz, and McClure 1999; Berg et al.
2003). This would indicate that the two FFV genotypes also
utilize the same receptor; however, additional studies of this interesting phenomenon are warranted to further explore this.

4.4 Recombination plays an important role in FFV
evolution and adaptation
We identified FFV recombinant regions spanning the complete
open reading frame of pol, whereas recombinant regions in env
are concentrated in the 50 and SU region. Hotspots in the 50
region of pol (Fig. 4C), and in the 50 and SU region of env (Fig. 4D)
relate to relatively high levels of variation in the FFV genome.
The env SU hotspot spans the 30 end of the SU coding region,
highlighting this site as an evolutionarily important breakpoint
region in the context of two co-circulating genetically distinct
Env genotypes. This env recombination breakpoint hotspot mirrors those detected in SFV’s (Galvin et al. 2013; Richard et al.
2015; Ensser et al. 2018). One recombination breakpoint coldspot

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

1925

Front range, CO, USA / Puma
Western slope, CO, USA / Puma
Florida, USA / Puma
California, USA / Puma
All locations / DC

|

�10

|

Virus Evolution, 2020, Vol. 6, No. 1

was identified in env approximately at 730 nt position (Fig. 4D),
a region encoding one of the receptor binding domains in
env SU. The lack of recombination breakpoints detected here
suggests its conservation is critical for viral function.
Recombination has also been frequently observed among SFVs
(Liu et al. 2008; Richard et al. 2015; Galvin et al. 2013) indicating
a precedent for our observations.

4.5 Feline FV substitution rates differ from other FVs

4.6 Host and spatial movement patterns evident in FFV
phylogeny
Puma isolates were grouped according to location, while domestic cat FFV isolates were analyzed as a single group in order
to best mitigate the effects of sampling bias from puma. The
BF supported transitions indicates a high probability of FFV
spillover from domestic cats to puma, as well as puma to puma
transmission (Fig. 5 and Supplementary Fig. S3). It’s worth noting a flexible non-parametric coalescent model was applied in
these analyses, which assumes all organisms are part of the
same population. Given the spatial/host dimensions of this
analyses this prior although not optimal was the most appropriate currently available. Nonetheless, we found that whilst there
was some support for puma to domestic cat cross-species transmission (BF ¼ 20), overwhelmingly the model supported domestic cat to puma transmission (BF ¼ 8,155) (Supplementary Fig.
S3). This is not surprising considering that interactions between
the puma predator and domestic cat prey make puma to domestic cat pathogen transmission events for directly transmitted agents biologically implausible. Spatial movement of FFV
via puma to puma transmission is strongly supported between
urban (FR) and rural (WS) locations (Fig. 5), which is likely propagated by dispersal of individuals. Our findings support FFV
transmission between domestic cat and puma in both urban
(California and Colorado FR) and rural (Colorado WS) areas, although the latter appears to be much more strongly supported.
There is potentially a high propensity for cross-species transmission in an urban area due to high densities of domestic cats
kept as pets (Moss et al. 2016). High risks for transmission in rural regions may be related to the higher number of outdoor cats
in these areas which are at risk for predation.

This study provides the first large-scale molecular analysis of
FFV infection in a free-ranging wild felid, and presents an indepth investigation of the viral dynamics and evolution within
puma populations in comparison to domestic cats. We document a remarkably high number of puma infected with FFV (including sequences from California, Colorado, and Florida),
approximating or exceeding seroprevalence rates in domestic
cats (Winkler, Löchelt, and Flower 1999; Phung et al. 2001).
Interestingly, phylogeny indicates that FFV from domestic cats
readily infects pumas suggesting limited innate or adaptive immune barriers exist to prohibit FFV cross-species transmission
between these hosts. Further, the differing phylogenetic patterns between Pol and Env maximum likelihood phylogenetic
trees indicate a complex and dynamic evolutionary history (Figs
2 and 3).
SFVs and FFVs share the unusual phenomenon of having
two distinct and unique co-circulating genotypes which vary
significantly in the receptor binding domain of Env. We show
here that these two distinct FFV genotypes commonly infect
both puma and domestic cats, though neither genotype exhibits
species specificity. Although the biological implications and origin(s) are unknown, it appears this region of FV is highly prone
to recombination in both felids and primates (Galvin et al. 2013;
Richard et al. 2015; Ensser et al. 2018). Further, the near equivalence of these two genotypes in prevalence suggests that the
two genotypes may be synergistic and/or dependent upon one
another, as a greater fitness of one genotype versus the other
would be accompanied by disproportionate occurrence of one
isolate (Moya, Holmes, and González-Candelas 2004).
Unlike another retroviral infection of puma, FIVpco (Lee et al.
2014), the phylogeny of FFV sequences displays little geographic
structure. Interestingly, here we see domestic cat derived FFV
sequences are interspersed throughout the phylogenetic trees,
and are situated either basal to, or clustered within, clades comprised of both domestic cat and puma isolates from the USA.
Further, internationally derived FFV domestic cat sequences
from Europe or Australia are also sporadically located across
the phylogenetic tree. This pattern is most easily explained by
owners relocating with their pet cats and/or historical trade
movements where cats were dispersed for the purpose of rodent control, both domestically and globally (Gehrt, Riley, and
Cypher 2010; Ottoni et al. 2017). Well-supported BF movements
are congruent with a co-circulating history in these two host
species, and strongly suggest that domestic cats may be an important factor for ‘seeding’ FFV into puma populations, followed
by subsequent spread from puma to puma (Fig. 5 and
Supplementary Fig. S3). Genetic and historical records indicate
the introduction of domestic cats to the New World occurred
with early European settlers �1,600 (Lipinski et al. 2008). It is
thought that settlers brought domestic cats to Colorado during
the Pike’s Peak gold rush of 1,858, and were well-established in
the state by the 1870s (Ross 2016). In the early to mid-1900s,
puma abundance throughout Colorado declined to a few hundred individuals, primarily due to unrestricted hunting and
predator control. From 1965 to present, human-caused mortality in pumas was restricted (Anderson et al. 2010), and as a result the puma population in Colorado have grown from as low
as a few hundred in 1965 to a few thousand adult and sub-adult
pumas (Cahalane 1964; Anderson et al. 2010; Apker 2017). When
puma numbers were low, interactions between pumas and
domestic cats would consequently be limited. Increases in
free-ranging puma populations, concurrent with increases in

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Substitution rates in FFV pol, �2.5 � 10�4 substitutions per site
per year (s/n/y), are considerably higher than rates reported for
SFV pol (�1.7 � 10�8 s/n/y; Switzer et al. 2005). Several factors
likely contribute to this difference. First, a 425 nt region of pol
was used in the SFV study (Switzer et al. 2005) compared with
the full �3,460 nt pol gene region analyzed here. Second, time
dependency, which refers to the differences between short- and
long-term studies, can alter estimates of FV evolutionary rates
(Aiewsakun and Katzourakis 2015; Membrebe et al. 2019). Tissue
type sampled may also attribute to calculation of different
substitution rates, as sampling of the virus from mucosa likely
represents an active infection, whereas viral sequences sampled from the blood represent latent infection (Soliven et al.
2013). The frequent transmission events of FFV in this dual-host
system may also be a factor in driving evolution rates.
Nevertheless, FFV substitution rates appear to be falling between reported rates for DNA and RNA viruses, and in the range
described for other retroviruses such as FIV (Peck and Lauring
2018; Krakoff et al. 2019).

5. Conclusion

�S. Kraberger et al.

Acknowledgements
We thank wildlife managers, scientists, veterinarians, and
support staff at Colorado Parks and Wildlife, Florida Fish
and Wildlife Conservation Commission, and National Park
Service including Dave Onorato, Mark Cunningham, and
Roy McBride. In addition we thank the Boulder Humane
Society and Community Cat Care shelter and the Ridgway
Second Chance shelter for their assistance providing samples, and Dr Julia Beatty at the University of Sydney for providing domestic cat samples from Australia. We are hugely
thankful to Guy Baele for his expert advice for the BEAST
analyses. Thanks to Daryl Trumbo for generating map features used in Fig. 1A.

11

Funding
This study was supported by NSF-EEID award 1413925.

Supplementary data
Supplementary data are available at Virus Evolution online.
Conflict of interest: No conflicts of interest.

References
Aiewsakun, P., and Katzourakis, A. (2015) ‘Time Dependency of
Foamy Virus Evolutionary Rate Estimates’, BMC Evolutionary
Biology, 15: 119.
Alais, S. et al. (2018) ‘STLV-1 Co-Infection is Correlated with an
Increased SFV Proviral Load in the Peripheral Blood of
SFV/STLV-1 Naturally Infected Non-Human Primates’, PLoS
Neglected Tropical Diseases, 12: e0006812.
Anderson, C. et al. (2010) ‘Cougar Management in North America’,
in M., Hornocker, and S., Negri (eds.) Cougar Ecology and
Conservation, pp. 41–54. Chicago, IL: University of Chicago Press.
Apker, J. (2017). ‘Colorado Mountain Lion Status Report’, in
McLaughlin, C. R., and Vieira, M. (eds.) Proceedings of the 12th
Mountain Lion Workshop, pp. 74–84. Estes Park, CO: Western
Association of Fish and Wildlife Agencies
Berg, A. et al. (2003) ‘Determinants of Foamy Virus Envelope
Glycoprotein Mediated Resistance to Superinfection’, Virology,
314: 243–52.
Betsem, E. et al. (2011) ‘Frequent and Recent Human Acquisition
of Simian Foamy Viruses through Apes’ Bites in Central
Africa’, PLoS Pathogens, 7: e1002306.
Bevins, S. N. et al. (2012) ‘Three Pathogens in Sympatric
Populations of Pumas, Bobcats, and Domestic Cats: Implications
for Infectious Disease Transmission’, PLoS One, 7: e31403.
Bielejec, F. et al. (2016) ‘SpreaD3: Interactive Visualization of
Spatiotemporal History and Trait Evolutionary Processes’,
Molecular Biology and Evolution, 33: 2167–9.
Bleiholder, A. et al. (2011) ‘Pattern of Seroreactivity against
Feline Foamy Virus Proteins in Domestic Cats from Germany’,
Veterinary Immunology and Immunopathology, 143: 292–300.
Bodem, J. et al. (1996) ‘Characterization of the Spliced Pol
Transcript of Feline Foamy Virus: The Splice Acceptor Site of
the Pol Transcript is Located in Gag of Foamy Viruses’, Journal
of Virology, 70: 9024–7.
Bouillant, A., and Ruckerbauer, G. (1984) ‘Isolation of Bovine
Syncytial Virus from Lymphocytes Recovered from Fluids
Used to Flush Uterus and Oviducts of Superovulated Cattle’,
Canadian Journal of Comparative Medicine, 48: 332.
Buseyne, F. et al. (2018) ‘Clinical Signs and Blood Test Results
among Humans Infected with Zoonotic Simian Foamy Virus: A
Case-Control Study’, The Journal of Infectious Diseases, 218:
144–51.
Cahalane, V. H. 1964. A Preliminary Study of Distribution and
Numbers of Cougar, Grizzly, and Wolf in North America. New York:
New York Zoological Society.
Calattini, S. et al. (2004) ‘Natural Simian Foamy Virus Infection in
Wild-Caught Gorillas, Mandrills and Drills from Cameroon and
Gabon’, Journal of General Virology, 85: 3313–7.
et al. (2006) ‘Modes of Transmission and Genetic Diversity of
Foamy Viruses in a Macaca tonkeana Colony’, Retrovirology, 3: 23.
Carver, S. et al. (2016) ‘Pathogen Exposure Varies Widely among
Sympatric Populations of Wild and Domestic Felids across the
United States’, Ecological Applications, 26: 367–81.

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

domestic cat ownership have likely influenced prevalence
trends recorded here that are congruent with general indications of FFV phylogenetic analysis. The very high level of
contemporary FFV infection/movement among pumas indicates
rapid fixation in the population. A similar pattern has been seen
for other pathogens, such as the �1980 canine parvovirus
pandemic, illustrating that a very contagious pathogen that
does not cause high morbidity can rapidly become endemic
(Parrish and Kawaoka 2005).
Interestingly, although identified in domestic cats and
puma, a homologous genotype of FFV is not known to infect
bobcats or Canada Lynx (Lynx canadensis), both of which have
overlapping geographic ranges with puma, and it has been
shown that bobcats will predate on domestic cats (Clark 2010).
This suggests that species-specific immunological or innate factors may limit FFV. FFV is present in the unique wild felid species which inhabits the island of Iriomote, Japan, an island that
has been geographically isolated for 200,000 years (Masuda and
Yoshida 1995). Despite harboring FFV the Iriomote wild cat population were negative for other major feline viral infections
such as feline immunodeficiency virus and feline leukemia virus (Mochizuki, Akuzawa, and Nagatomo 1990), thereby supporting an ancient ancestral origin. More extensive molecular
investigations into FFV infecting other wild felid species globally
would shed further light on the evolutionary history of what is
believed to be one of the oldest known exogenous vertebrate
RNA virus families (Rethwilm and Bodem 2013).
Given its high prevalence, and the unlikelihood that FFV
would be transmitted from puma to domestic cats (since the domestic cats are unlikely to survive such an encounter), FFV provides an interesting and unique viral ‘fingerprint’ that can map
puma movements and augment studies of individual and population movements in this wide-ranging and secretive apex predator (Fountain-Jones et al. 2018). Although FVs evolve slowly,
we document FFV substitution rates that are more rapid than
predicted by previous FV mutation rate estimates. This may be
due to adaptation to a new host species and pervasive interand intra-species transmission, and provides an opportunity to
better study transmission events within and between species.
The information gained here elucidating the evolution and
cross-species transmission dynamics of a highly prevalent but
apathogenic virus can be further applied to model more virulent
disease, such as that caused by feline leukemia virus, which is a
major threat to the endangered Florida panther (Cunningham
et al. 2008; Chiu et al. 2019).

|

�12

|

Virus Evolution, 2020, Vol. 6, No. 1

Information’, Photogrammetric Engineering &amp; Remote Sensing, 81:
345–54.
Jarosz, A. F., and Wiley, J. (2014) ‘What Are the Odds? A Practical
Guide to Computing and Reporting Bayes Factors’, The Journal
of Problem Solving, 7: 2.
Kechejian, S. R. et al. (2019) ‘Feline Foamy Virus is Highly
Prevalent in Free-Ranging Puma concolor from Colorado, Florida
and Southern California’, Viruses, 11: 359.
Kehl, T. et al. (2013) ‘Complete Genome Sequences of Two Novel
Puma concolor Foamy Viruses from California’, Genome
Announcements, 1: e00201–12.
, Tan, J., and Materniak, M. (2013) ‘Non-Simian Foamy
Viruses: Molecular Virology, Tropism and Prevalence and
Zoonotic/Interspecies Transmission’, Viruses, 5: 2169–209.
Kellner, A. et al. (2018) ‘Transmission Pathways and Spillover of
an Erythrocytic Bacterial Pathogen from Domestic Cats to Wild
Felids’, Ecology and Evolution, 8: 9779.
Khan, A. S. et al. (2018) ‘Spumaretroviruses: Updated Taxonomy
and Nomenclature’, Virology, 516: 158–64.
Krakoff, E. et al. (2019) ‘Variation in Intra-Individual Lentiviral
Evolution Rates: A Systematic Review of Human, Non-Human
Primate and Felid Species’, Journal of Virology,
Lambert, C. et al. (2018) ‘Potent Neutralizing Antibodies
in Humans Infected with Zoonotic Simian Foamy Viruses
Target Conserved Epitopes Located in the Dimorphic
Domain of the Surface Envelope Protein’, PLoS Pathogens, 14:
e1007293.
Lee, J. S. et al. (2014) ‘Evolution of Puma Lentivirus in Bobcats
(Lynx rufus) and Mountain Lions (Puma concolor) in North
America’, Journal of Virology, 00473–14.
Lee, J. et al. (2017a) ‘Feline Immunodeficiency Virus
Cross-Species Transmission: Implications for Emergence of
New Lentiviral Infections’, Journal of Virology, 91:
Lee, J. S. et al. (2017b) ‘Targeted Enrichment for Pathogen
Detection and Characterization in Three Felid Species’, Journal
of Clinical Microbiology, 55: 1658–70.
Lefort, V., Longueville, J.-E., and Gascuel, O. (2017) ‘SMS: Smart
Model Selection in PhyML’, Molecular Biology and Evolution, 34:
2422–4.
Letunic, I., and Bork, P. (2016) ‘Interactive Tree of Life (iTOL) v3:
An Online Tool for the Display and Annotation of Phylogenetic
and Other Trees’, Nucleic Acids Research, 44: W242–5.
Lipinski, M. J. et al. (2008) ‘The Ascent of Cat Breeds: Genetic
Evaluations of Breeds and Worldwide Random-Bred
Populations’, Genomics, 91: 12–21.
Liu, W. et al. (2008) ‘Molecular Ecology and Natural History of
Simian Foamy Virus Infection in Wild-Living Chimpanzees’,
PLoS Pathogens, 4: e1000097.
Luther, P., Nuttall, P., and Gibbons, R. (1978) ‘Isolation of Viruses
from Cultures of Bovine Endometrial Cells’, Journal of Infectious
Diseases, 138: 660–3.
Martin, D. P. et al. (2015) ‘RDP4: Detection and Analysis of
Recombination Patterns in Virus Genomes’, Virus Evolution, 1:
vev003.
Masuda, R., and Yoshida, M. C. (1995) ‘Two Japanese Wildcats,
the Tsushima Cat and the Iriomote Cat, Show the Same
Mitochondrial DNA Lineage as the Leopard Cat (Felis bengalensis)’, Zoological Science, 12: 655–9.
�mak, J. (2006) ‘Isolation and
Materniak, M., Bicka, L., and Kuz
Partial Characterization of Bovine Foamy Virus from Polish
Cattle’, Polish Journal of Veterinary Sciences, 9: 207–11.
Membrebe, J. V. et al. (2019) ‘Bayesian Inference of Evolutionary
Histories under Time-Dependent Substitution Rates’, Molecular
Biology and Evolution, 36: 1793.,

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Cavalcante, L. et al. (2018) ‘Clinical and Molecular Features of
Feline Foamy Virus and Feline Leukemia Virus Co-Infection in
Naturally-Infected Cats’, Viruses, 10: 702.
Chaudhary, V. et al. (2018) ‘Risk of Disease Spillover from Dogs to
Wild Carnivores in Kanha Tiger Reserve, India’, bioRxiv, 360271.
Chiu, E. S. et al. (2019) ‘Multiple Introductions of Domestic Cat
Feline Leukemia Virus in Endangered Florida Panthers’,
Emerging Infectious Diseases, 25: 92.
Choudhary, A. et al. (2013) ‘Influence of Naturally Occurring
Simian Foamy Viruses (SFVs) on SIV Disease Progression in the
Rhesus Macaque (Macaca mulatta) Model’, Viruses, 5: 1414–30.
Clark, H. O., Jr. (2010) ‘Urban Carnivores: Ecology, Conflict, and
Conservation by SD Gehrt, SPD Riley, and BL Cypher [Editors]’,
Western North American Naturalist, 70: 20.
Cunningham, M. W. et al. (2008) ‘Epizootiology and Management
of Feline Leukemia Virus in the Florida Puma’, Journal of
Wildlife Diseases, 44: 537–52.
Daniels, M. et al. (1999) ‘Feline Viruses in Wildcats from
Scotland’, Journal of Wildlife Diseases, 35: 121–4.
Darriba, D. et al. (2011) ‘ProtTest 3: Fast Selection of Best-Fit
Models of Protein Evolution’, Bioinformatics, 27: 1164–5.
Di Pietro, F. et al. (2011) ‘Genomic DNA Extraction from Whole
Blood Stored from 15- to 30-Years at �20� C by Rapid
Phenol–Chloroform Protocol: A Useful Tool for Genetic
Epidemiology Studies’, Molecular and Cellular Probes, 25: 44–8.
Drummond, A. J., and Rambaut, A. (2007) ‘BEAST: Bayesian
Evolutionary Analysis by Sampling Trees’, BMC Evolutionary
Biology, 7: 214.
Ensser, A. et al. (2018) ‘Isolation and Sequence Analysis of a
Novel Rhesus Macaque Foamy Virus Isolate with a
Serotype-1-like Env’, Archives of Virology, 163: 2507–12.
Fountain-Jones, N. M. et al. (2018) ‘Towards an Eco-Phylogenetic
Framework for Infectious Disease Ecology’, Biological Reviews,
93: 950–70.
Franklin, S. P. et al. (2007) ‘Frequent Transmission of
Immunodeficiency Viruses among Bobcats and Pumas’, Journal
of Virology, 81: 10961–9.
Galvin, T. A. et al. (2013) ‘Identification of Recombination in the
Envelope Gene of Simian Foamy Virus Serotype 2 Isolated
from Macaca cyclopis’, Journal of Virology, 87: 8792–7.
Gehrt, S. D., Riley, S. P., and Cypher, B. L. (2010) Urban Carnivores:
Ecology, Conflict, and Conservation. Baltimore, MD: JHU Press.
Guindon, S. et al. (2010) ‘New Algorithms and Methods to
Estimate Maximum-Likelihood Phylogenies: Assessing the
Performance of PhyML 3.0’, Systematic Biology, 59: 307–21.
Han, G.-Z., and Worobey, M. (2012) ‘An Endogenous Foamy-Like
Viral Element in the Coelacanth Genome’, PLoS Pathogens, 8:
e1002790.
, and
(2012) ‘An Endogenous Foamy Virus in the
Aye-Aye (Daubentonia madagascariensis)’, Journal of Virology, 86:
7696–8.
Hatama, S. et al. (2001) ‘Reactivation of Feline Foamy Virus from
a Chronically Infected Feline Renal Cell Line by Trichostatin A’,
Virology, 283: 315–23.
Helps, C., and Harbour, D. (1997) ‘Comparison of the Complete
Sequence of Feline Spumavirus with Those of the Primate
Spumaviruses Reveals a Shorter Gag Gene’, Journal of General
Virology, 78: 2549–64.
Hill, C. L., Bieniasz, P. D., and McClure, M. O. (1999) ‘Properties of
Human Foamy Virus Relevant to Its Development as a Vector
for Gene Therapy’, Journal of General Virology, 80: 2003–9.
HomerC. et al. (2015) ‘Completion of the 2011 National Land
Cover
Database
for
the
Conterminous
United
States–representing a Decade of Land Cover Change

�S. Kraberger et al.

13

Rethwilm, A., and Bodem, J. (2013) ‘Evolution of Foamy Viruses:
The Most Ancient of All Retroviruses’, Viruses, 5: 2349–74.
Richard, L. et al. (2015) ‘Cocirculation of Two Env Molecular
Variants, of Possible Recombinant Origin, in Gorilla and
Chimpanzee Simian Foamy Virus Strains from Central Africa’,
Journal of Virology, 89: 12480–91.
Ross, A. (2016) Celebrity Cats of Colorado History. Denver News
&lt;https://history.denverlibrary.org/news/cats-co-not-real-title&gt;
accessed 23 December 2019.
Soliven, K. et al. (2013) ‘Simian Foamy Virus Infection of Rhesus
Macaques in Bangladesh: Relationship of Latent Proviruses
and Transcriptionally Active Viruses’, Journal of Virology,
01989–13.
Stöver, B. C., and Müller, K. F. (2010) ‘TreeGraph 2: Combining
and Visualizing Evidence from Different Phylogenetic
Analyses’, BMC Bioinformatics, 11: 7.
Switzer, W. M. et al. (2004) ‘Frequent Simian Foamy Virus
Infection in Persons Occupationally Exposed to Nonhuman
Primates’, Journal of Virology, 78: 2780–9.
et al. (2008) ‘Coinfection with HIV-1 and Simian Foamy
Virus in West Central Africans’, The Journal of Infectious
Diseases, 197: 1389–93.
et al. (2005) ‘Ancient co-Speciation of Simian Foamy
Viruses and Primates’, Nature, 434: 376.
Troyer, R. M. et al. (2014) ‘Novel Gammaherpesviruses
in North American Domestic Cats, Bobcats and Pumas:
Identification, Prevalence and Risk Factors’, Journal of
Virology, 03405–13.
Wei, X. et al. (2019) ‘A Reptilian Endogenous Foamy Virus Sheds
Light on the Early Evolution of Retroviruses’, Virus Evolution, 5:
vez001.
Wiethoelter, A. K. et al. (2015) ‘Global Trends in Infectious
Diseases at the Wildlife–Livestock Interface’, Proceedings of the
National Academy of Sciences of the United States of America, 112:
9662–7.
Winkler, I. G. et al. (1998) ‘Detection and Molecular
Characterisation of Feline Foamy Virus Serotypes in Naturally
Infected Cats’, Virology, 247: 144–51.
, Löchelt, M., and Flower, R. L. P. (1999) ‘Epidemiology of
Feline Foamy Virus and Feline Immunodeficiency Virus
Infections in Domestic and Feral Cats: A Seroepidemiological
Study’, Journal of Clinical Microbiology, 37: 2848–51.
Xu, X. et al. (2018) ‘Endogenous Retroviruses of
Non-Avian/Mammalian Vertebrates Illuminate Diversity and
Deep History of Retroviruses’, PLoS Pathogens, 14: e1007072.

Downloaded from https://academic.oup.com/ve/article/6/1/vez058/5700824 by guest on 07 July 2021

Minin, V. N., Bloomquist, E. W., and Suchard, M. A. (2008)
‘Smooth Skyride through a Rough Skyline: Bayesian CoalescentBased Inference of Population Dynamics’, Molecular Biology and
Evolution, 25: 1459–71.
Mochizuki, M., Akuzawa, M., and Nagatomo, H. (1990)
‘Serological Survey of the Iriomote Cat (Felis iriomotensis) in
Japan’, Journal of Wildlife Diseases, 26: 236–45.
Moss, W. E. et al. (2016) ‘Human Expansion Precipitates Niche
Expansion for an Opportunistic Apex Predator (Puma concolor)’,
Scientific Reports, 6: 39639.
Mouinga-Ondémé, A. et al. (2012) ‘Cross-Species Transmission
of Simian Foamy Virus to Humans in Rural Gabon, Central
Africa’, Journal of Virology, 86: 1255–60.
Moya, A., Holmes, E. C., and González-Candelas, F. (2004) ‘The
Population Genetics and Evolutionary Epidemiology of RNA
Viruses’, Nature Reviews Microbiology, 2: 279.
Murray, S. M., and Linial, M. (2006) ‘Foamy Virus Infection in
Primates’, Journal of Medical Primatology, 35: 225–35.
Nakamura, K. et al. (2000) ‘Contrastive Prevalence of Feline
Retrovirus Infections between Northern and Southern
Vietnam’, Journal of Veterinary Medical Science, 62: 921–3.
Ottoni, C. et al. (2017) ‘The Palaeogenetics of Cat Dispersal in the
Ancient World’, Nature Ecology &amp; Evolution, 1: 0139.
Parrish, C. R., and Kawaoka, Y. (2005) ‘The Origins of New
Pandemic Viruses: The Acquisition of New Host Ranges by
Canine Parvovirus and Influenza a Viruses’, Annual Review of
Microbiology, 59: 553.
Peck, K. M., and Lauring, A. S. (2018) ‘The Complexities of Viral
Mutation Rates’, Journal of Virology,
Phung, H. T. et al. (2001) ‘Genetic Analyses of Feline Foamy Virus
Isolates from Domestic and Wild Feline Species in
Geographically Distinct Areas’, Virus Research, 76: 171–81.
Posada, D. (2009) ‘Selection of Models of DNA Evolution with
jModelTest’ in Posada (ed.) Bioinformatics for DNA sequence
analysis Methods in Molecular Biology. New York: Humana Press.
Powers, J. A. et al. (2018) ‘Feline Leukemia Virus Disease
Outcomes in a Domestic Cat Breeding Colony: Relationship to
Endogenous FeLV and Other Chronic Viral Infections’, Journal
of Virology, 00649–18.
Rambaut, A. (2012) FigTree v1. 4. Institute of Evolutionary
Biology, University of Edinburgh &lt;http://tree.bio.ed.ac.uk/soft
ware/figtree/&gt; accessed 23 December 2019.
et al. (2016) ‘Exploring the Temporal Structure of
Heterochronous Sequences Using TempEst (Formerly
Path-O-Gen)’, Virus Evolution, 2: vew007.

|

�</text>
                </elementText>
              </elementTextContainer>
            </element>
          </elementContainer>
        </elementSet>
      </elementSetContainer>
    </file>
    <file fileId="118">
      <src>https://cpw.cvlcollections.org/files/original/0337545f1f7a565e988e9e32ed8e351b.zip</src>
      <authentication>4feb086aa532616b5ac55e2e6acf2ce2</authentication>
    </file>
  </fileContainer>
  <collection collectionId="2">
    <elementSetContainer>
      <elementSet elementSetId="1">
        <name>Dublin Core</name>
        <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
        <elementContainer>
          <element elementId="50">
            <name>Title</name>
            <description>A name given to the resource</description>
            <elementTextContainer>
              <elementText elementTextId="479">
                <text>Journal Articles</text>
              </elementText>
            </elementTextContainer>
          </element>
          <element elementId="41">
            <name>Description</name>
            <description>An account of the resource</description>
            <elementTextContainer>
              <elementText elementTextId="7018">
                <text>CPW peer-reviewed journal publications</text>
              </elementText>
            </elementTextContainer>
          </element>
        </elementContainer>
      </elementSet>
    </elementSetContainer>
  </collection>
  <itemType itemTypeId="1">
    <name>Text</name>
    <description>A resource consisting primarily of words for reading. Examples include books, letters, dissertations, poems, newspapers, articles, archives of mailing lists. Note that facsimiles or images of texts are still of the genre Text.</description>
  </itemType>
  <elementSetContainer>
    <elementSet elementSetId="1">
      <name>Dublin Core</name>
      <description>The Dublin Core metadata element set is common to all Omeka records, including items, files, and collections. For more information see, http://dublincore.org/documents/dces/.</description>
      <elementContainer>
        <element elementId="50">
          <name>Title</name>
          <description>A name given to the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1252">
              <text>Frequent cross-species transmissions of foamy virus between domestic and wild felids</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="47">
          <name>Rights</name>
          <description>Information about rights held in and over the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1253">
              <text>&lt;a href="http://rightsstatements.org/vocab/InC-NC/1.0/" target="_blank" rel="noreferrer noopener"&gt;In Copyright - Non-Commercial Use Permitted&lt;/a&gt;</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="56">
          <name>Date Created</name>
          <description>Date of creation of the resource.</description>
          <elementTextContainer>
            <elementText elementTextId="1254">
              <text>2020-01-12</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="49">
          <name>Subject</name>
          <description>The topic of the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1255">
              <text>Feline foamy virus</text>
            </elementText>
            <elementText elementTextId="1256">
              <text>Retrovirus</text>
            </elementText>
            <elementText elementTextId="1257">
              <text>Cross-species transmission</text>
            </elementText>
            <elementText elementTextId="1258">
              <text>Puma</text>
            </elementText>
            <elementText elementTextId="1259">
              <text>Domestic cat</text>
            </elementText>
            <elementText elementTextId="1260">
              <text>Recombination</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="41">
          <name>Description</name>
          <description>An account of the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1261">
              <text>&lt;span&gt;Emerging viral outbreaks resulting from host switching is an area of continued scientific interest. Such events can result in disease epidemics or in some cases, clinically silent outcomes. These occurrences are likely relatively common and can serve as tools to better understand disease dynamics, and may result in changes in behavior, fecundity, and, ultimately survival of the host. Feline foamy virus (FFV) is a common retrovirus infecting domestic cats globally, which has also been documented in the North American puma (&lt;/span&gt;&lt;em&gt;Puma concolor&lt;/em&gt;&lt;span&gt;). The prevalent nature of FFV in domestic cats and its ability to infect wild felids, including puma, provides an ideal system to study cross-species transmission across trophic levels (positions in the food chain), and evolution of pathogens transmitted between individuals following direct contact. Here we present findings from an extensive molecular analysis of FFV in pumas, focused on two locations in Colorado, and in relation to FFV recovered from domestic cats in this and previous studies. Prevalence of FFV in puma was high across the two regions, ∼77 per cent (urban interface site) and ∼48 per cent (rural site). Comparison of FFV from pumas living across three states; Colorado, Florida, and California, indicates FFV is widely distributed across North America. FFV isolated from domestic cats and pumas was not distinguishable at the host level, with FFV sequences sharing &amp;gt;93 per cent nucleotide similarity. Phylogenetic, Bayesian, and recombination analyses of FFV across the two species supports frequent cross-species spillover from domestic cat to puma during the last century, as well as frequent puma-to-puma intraspecific transmission in Colorado, USA. Two FFV variants, distinguished by significant difference in the surface unit of the envelope protein, were commonly found in both hosts. This trait is also shared by simian foamy virus and may represent variation in cell tropism or a unique immune evasion mechanism. This study elucidates evolutionary and cross-species transmission dynamics of a highly prevalent multi-host adapted virus, a system which can further be applied to model spillover and transmission of pathogenic viruses resulting in widespread infection in the new host.&lt;/span&gt;</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="39">
          <name>Creator</name>
          <description>An entity primarily responsible for making the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1263">
              <text>Kraberger, Simona</text>
            </elementText>
            <elementText elementTextId="1264">
              <text>Fountain-Jones, Nicholas M.</text>
            </elementText>
            <elementText elementTextId="1265">
              <text>Gagne, Roderick B.</text>
            </elementText>
            <elementText elementTextId="1266">
              <text>Malmberg, Jennifer</text>
            </elementText>
            <elementText elementTextId="1267">
              <text>Dannemiller, Nicholas G.</text>
            </elementText>
            <elementText elementTextId="1268">
              <text>Logan, Kenneth A.&#13;
</text>
            </elementText>
            <elementText elementTextId="1270">
              <text>Varsani, Arvind</text>
            </elementText>
            <elementText elementTextId="1271">
              <text>Crooks, Kevin R.</text>
            </elementText>
            <elementText elementTextId="1272">
              <text>Craft, Meggan</text>
            </elementText>
            <elementText elementTextId="1273">
              <text>Carver, Scott</text>
            </elementText>
            <elementText elementTextId="1274">
              <text>VandeWoude, Sue</text>
            </elementText>
            <elementText elementTextId="1290">
              <text>Alldredge, Mathew W.</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="44">
          <name>Language</name>
          <description>A language of the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1275">
              <text>English</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="70">
          <name>Is Part Of</name>
          <description>A related resource in which the described resource is physically or logically included.</description>
          <elementTextContainer>
            <elementText elementTextId="1276">
              <text>Virus Evolution</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="42">
          <name>Format</name>
          <description>The file format, physical medium, or dimensions of the resource</description>
          <elementTextContainer>
            <elementText elementTextId="1277">
              <text>application/pdf</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="78">
          <name>Extent</name>
          <description>The size or duration of the resource.</description>
          <elementTextContainer>
            <elementText elementTextId="1278">
              <text>13 pages</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="80">
          <name>Bibliographic Citation</name>
          <description>A bibliographic reference for the resource. Recommended practice is to include sufficient bibliographic detail to identify the resource as unambiguously as possible.</description>
          <elementTextContainer>
            <elementText elementTextId="1279">
              <text>Kraberger, S., N. M. Fountain-Jones, R. B. Gagne, J. Malmberg, N. G. Dannemiller, K. Logan, M. Alldredge, A. Varsani, K. R. Crooks, M. Craft, S. Carver, and S. VandeWoude. 2020. Frequent cross-species transmissions of foamy virus between domestic and wild felids. Virus Evolution 6(1):vez058. &lt;a href="https://doi.org/10.1093/ve/vez058" target="_blank" rel="noreferrer noopener"&gt;https://doi.org/10.1093/ve/vez058&lt;/a&gt;</text>
            </elementText>
          </elementTextContainer>
        </element>
        <element elementId="51">
          <name>Type</name>
          <description>The nature or genre of the resource</description>
          <elementTextContainer>
            <elementText elementTextId="7143">
              <text>Article</text>
            </elementText>
          </elementTextContainer>
        </element>
      </elementContainer>
    </elementSet>
  </elementSetContainer>
</item>
